Cxcr3 Mouse Gene Knockout Kit (CRISPR)
CAT#: KN304051LP
Cxcr3 - mouse gene knockout kit via CRISPR, HDR mediated
Functional Cassette: GFP-puro RFP-BSD mBFP-Neo
HDR-mediated knockout kit validation
Product Images
Specifications
| Product Data | |
| Format | 2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control |
| Donor DNA | Luciferase-Puro |
| Symbol | Cxcr3 |
| Locus ID | 12766 |
| Components | KN304051G1, Cxcr3 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GGTATCCGAGCTCGGCCACT KN304051G2, Cxcr3 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: CGGATACCAGGGACAAGCGT KN304051LPD, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette. GE100003, scramble sequence in pCas-Guide vector |
| Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
| Reference Data | |
| RefSeq | NM_009910 |
| UniProt ID | O88410 |
| Synonyms | Cd183; Cmkar3 |
| Summary | This gene encodes a transmembrane protein that functions as a receptor for C-X-R chemokines. Signalling through this protein regulates a variety of biological processes, including inflammation, immunity, and would healing. This protein also plays a role in tumor growth and metastasis. [provided by RefSeq, May 2015] |
Documents
| Product Manuals |
| FAQs |
|
| SDS |
Resources
Other Versions
| SKU | Description | Size | |
|---|---|---|---|
| KN304051 | Cxcr3 - mouse gene knockout kit via CRISPR, HDR mediated | 1 657,00 EUR | |
| KN304051BN | Cxcr3 - mouse gene knockout kit via CRISPR, HDR mediated | 1 657,00 EUR | |
| KN304051RB | Cxcr3 - mouse gene knockout kit via CRISPR, HDR mediated | 1 657,00 EUR | |
| KN504051 | Cxcr3 - KN2.0, Mouse gene knockout kit via CRISPR, non-homology mediated. | 1 657,00 EUR | |
| GA200768 | Cxcr3 CRISPRa kit - CRISPR gene activation of mouse chemokine (C-X-C motif) receptor 3 | 1 657,00 EUR |